Compartilhar
Informação da revista
Vol. 94. Núm. 6.
Páginas 658-663 (01 Novembro 2019)
Visitas
...
Vol. 94. Núm. 6.
Páginas 658-663 (01 Novembro 2019)
Investigação
Open Access
Falta de associação entre mutação no IL36RN e psoríase pustulosa palmoplantar em pacientes chineses
Visitas
...
Yu Xiaoling, Shu Dan, Jin Hongzhong
Autor para correspondência
jinhongzhong@263.net

Autor para correspondência.
Departamento de Dermatologia, Hospital‐Escola Peking Union, Academia Chinesa de Ciências Médicas, Faculdade de Medicina Peking Union, Pequim, China
Informação do artigo
Resume
Texto Completo
Bibliografia
Baixar PDF
Estatísticas
Figuras (2)
Tabelas (2)
Tabela 1. Sequências dos primers de éxons do IL36RN e comprimentos de amplicon da PCR
Tabela 2. Características demográficas dos pacientes com pustulose palmoplantar
Mostrar maisMostrar menos
Resumo
Fundamentos

A pustulose palmoplantar é considerada uma forma de psoríase pustulosa localizada, confinada às palmas das mãos e plantas dos pés. A mutação do gene IL36RN, que codifica o antagonista do receptor da interleucina‐36 (IL‐36Ra), está associada à psoríase pustulosa generalizada, mas mutações do IL36RN em pacientes chineses com pustulose palmoplantar não foram previamente investigadas.

Objetivo

Avaliar a mutação do IL36RN em pacientes chineses com pustulose palmoplantar.

Métodos

O estudo incluiu 51 pacientes chineses da etnia Han com pustulose palmoplantar. Todos os éxons e sequências de éxon‐íntron do IL36RN foram amplificados por reações em cadeia da polimerase e foi feito o sequenciamento Sanger dos amplicons.

Resultados

Entre os 51 pacientes com pustulose palmoplantar, quatro substituições de base única foram identificadas em nove pacientes. As mutações foram c.140A>G/p.Asn47Ser em cinco pacientes, c.258G>A/p.Met86IIe em dois pacientes e c.115+6T>C e c.169G>A/p.Val57IIe em um paciente cada. Todas as mutações eram heterozigóticas. A comparação com o banco de dados do genoma humano e a literatura consultada sugerem que essas variantes podem não ser mutações patogênicas causadoras de PPP. Além disso, não foi observada diferença na gravidade da doença, idade de início ou duração da doença entre pacientes com e sem variantes heterozigóticas de IL36RN (p > 0,1).

Limitação do estudo

Não foi feita avaliação adicional da proteína IL36Ra nas lesões de pustulose palmoplantar.

Conclusões

As quatro variantes do IL36RN identificadas aparentemente não estavam associadas aos fenótipos específicos de pustulose palmoplantar.

Palavras‐chave:
Genes
Mutação
Psoríase
Texto Completo
Introdução

A pustulose palmoplantar (PPP) é uma doença inflamatória crônica da pele, recidivante, restrita às palmas das mãos e plantas dos pés. A PPP é mais frequentemente observada em adultos de meia‐idade e mulheres e geralmente é resistente à terapia.1 Vários fatores estão associados à PPP, como alergia a metais, tabagismo, infecção e doenças da tireoide.2,3 Eritema, pústulas estéreis e escamas são características clínicas comumente observadas. A histopatologia mostra paraceratose, hiperplasia psoriasiforme da epiderme, espongiose e pústulas preenchidas por neutrófilos. A PPP apresenta muitas características clínicas e histológicas da psoríase pustulosa generalizada (PPG) e, assim, é considerada um tipo localizado de PPG.4 A PPG se apresenta como eritema edematoso, com pústulas estéreis em todo o corpo.

Sabe‐se que, em pacientes com história familiar e sem psoríase vulgar, a PPG é causada principalmente por mutações homozigóticas ou mutações heterozigóticas compostas do gene IL36RN, que codifica um antagonista das isoformas de IL‐36, inclusive IL‐36α, IL‐36β e IL‐36.5 A IL‐36 desencadeia uma reação pró‐inflamatória pelas vias de sinalização da proteína quinase ativada por mitógeno e fator nuclear‐kB. A mutação do IL36RN causa deficiência estrutural e funcional da IL‐36Ra, que então se torna incapaz de inibir uma reação inflamatória anormal mediada pela IL‐36 e seu receptor.6 A relação entre IL36RN e PPP também foi estudada, mas os resultados são controversos. Estudos feitos no Japão e na Europa sugeriram que a PPP não está associada a uma mutação do IL36RN.7,8 No entanto, outro estudo europeu indicou que a PPG e a PPP fundamentam um espectro da psoríase pustulosa associada a variantes do IL36RN.9 O presente estudo teve como objetivo investigar a associação entre IL36RN e PPP em pacientes chineses, determinar a relação entre IL36RN e PPP e contribuir com dados que elucidem o papel do IL36RN na doença pustulosa em diferentes etnias.

MétodosPacientes

O estudo incluiu 51 pacientes chineses da etnia Han com PPP na fase ativa da doença, atendidos no Departamento de Dermatologia do Hospital‐Escola da Faculdade de Medicina Peking Union entre 2014 e 2016. Os pacientes foram diagnosticados pelos mesmos dois dermatologistas especializados de acordo com as manifestações clínicas, com ou sem exame histopatológico. Pacientes grávidas e aqueles com síndrome SAPHO (sinovite, acne, pustulose, hiperostose e osteíte) foram excluídos. A gravidade da doença foi avaliada pelo Índice de Área e Gravidade da PPP (IASPPP), que avalia a área [0]de comprometimento (escore: 0 = nenhum; 0 < 1 ≤ 10%; 10% < 2 ≤ 30%; 30% < 3 ≤ 50%; 50% < 4 ≤ 70%; 70% < 5 ≤ 90%; 90% < 6 ≤ 100%) e pela gravidade de cada um dos três sinais clínicos cutâneos: eritema (E), pústulas (P) e descamação (D) (escore: 0 = nenhum; 1 = leve; 2 = moderado; 3 = grave; 4 = muito grave).10 O IASPPP final foi calculado pela área (E + P + D) × 0,2 (palma direita) + (E + P + D) área × 0,2 (palma esquerda) + (E + P + D) área × 0,3 (planta do pé direito) + (E + P + D) área × 0,2 (planta do pé esquerdo), que varia de 0 a 72. Características demográficas dos pacientes, idade de início da PPP, duração da doença e história familiar foram coletadas em entrevistas. Todos os participantes assinaram um termo de consentimento livre e esclarecido. O estudo foi aprovado pelo Comitê de Ética Médica do Hospital‐Escola [0]da Faculdade de Medicina Peking Union. Este trabalho foi conduzido de acordo com os princípios da Declaração de Helsinque.

Detecção da mutação

Foram coletadas amostras de sangue de todos os 51 pacientes. O DNA genômico foi extraído de leucócitos do sangue periférico com o kit Axy Prep Blood Genomic DNA Miniprep (Axygen Biosciences – Tewksbury, MA, EUA). A sequência do gene IL36RN foi obtida no GenBank (NM_012275). Sete pares de primers para a amplificação por reação em cadeia da polimerase (PCR) do IL36RN foram projetados com Primer 5 (http://primer5.ut.ee/) e sintetizados pela Majorbio Company (Shanghai, China; tabela 1). Todos os cinco éxons que codificam IL36RN, bem como seus íntrons flanqueadores, foram amplificados por PCR com o DNA genômico extraído como modelo. O volume total das reações foi de 50μL: 25 de 2×EasyTaq PCR Super Mix, 4μL de DNA, 2μL de primer direto, 2μL de primer inverso e 17μL de água bidestilada. As condições de amplificação foram as seguintes: uma pré‐desnaturação a 94°C por 5min, 35 ciclos de desnaturação a 94°C por 30 s, emparelhamento a 60°C por 30 s e extensão a 72°C por 1min, e uma reação de extensão final foi feita a 72°C por 7min. Os produtos de PCR foram verificados por eletroforese em gel de agarose e observação sob luz ultravioleta. A purificação e o sequenciamento do DNA foram feitos pela Majorbio Company. A função provável das sequências de proteínas mutantes foi avaliada com os instrumentos de previsão de patogenicidade SIFT e/ou PolyPhen.

Tabela 1.

Sequências dos primers de éxons do IL36RN e comprimentos de amplicon da PCR

  Primer direto (5’–3’)  Primer reverso (5’3’)  bp 
IL‐36RN‐1  AGTGCTTCTGGCGACTTAGG  GGAGAGAGAGGCTGAGTTGG  276 
IL‐36RN‐2  CTGACCCCAGACCCAGAATC  AGCTGGACAACGGGTCTATC  261 
IL‐36RN‐3  GTTACTTCTGGCACAGTAGG  CACTTTGCTGAGAGGTGTAG  392 
IL‐36RN‐4  TCATGACAGCTGCTGAGAAG  AGCTGCCATCAACAGAATCC  386 
IL‐36RN‐5.1  AGATGCTGAGCCTACTGAAG  TCTGACATCAGCACCTCCTC  950 
IL‐36RN‐5.2  TAGAGTCAGGGATCTATGGC  GTGTCCTCTCCTTTTCATAC  940 
IL‐36RN‐5.3  CAAATTCACATCCTTCTTGG  GGGTAAATGAAGGATAGTTG  917 

bp, par de bases.

Análise estatística

O software SPSS v. 20.0 (SPSS, Inc. – Chicago, IL, EUA) foi usado para a análise dos dados. Médias e desvios‐padrão foram comparados entre pacientes com e sem mutação do IL36RN com o teste t de Student para amostras independentes. Quando os dados não apresentavam distribuição normal, o teste U de Mann‐Whitney foi usado para calcular a significância estatística. Um modelo de regressão logística de duas classes foi aplicado para comparar pacientes com e sem mutações heterozigóticas do IL36RN, ajustadas por fatores de risco (sexo, idade e história familiar de PPP). O nível de significância usado foi p ≤ 0,05.

Resultados

Este estudo incluiu 35 pacientes do sexo feminino e 16 do masculino. A média de idade dos pacientes foi de 48,9 ± 11,9 anos e a idade média de início da PPP foi de 45,0 ± 11,9 anos. A duração média da PPP foi de 38,7 ± 62,2 meses. Nenhum paciente apresentou histórico familiar de PPP. O escore IASPPP médio de todos os pacientes foi de 15,1 ± 10,9 (tabela 2).

Tabela 2.

Características demográficas dos pacientes com pustulose palmoplantar

  Número de pacientes  Histórico familiar  Idade média  Idade média de início da PPP  Duração mediana da doença (percentil 25, percentil 75), em meses  Média IASPPP 
Total (masculino/feminino)  51 (16/35)  48,9 ± 11,9 (intervalo: 26–78)  45,0 ± 11,9(intervalo: 24–63)  14 (6, 36)  15,1 ± 10,9 (intervalo: 1,2–49,0) 
Pacientes com mutações heterozigóticas do IL36RN  9 (2/7)  52,5 ± 8,4(intervalo: 40–66)  48,7 ± 7,1(intervalo: 40–62)  12,5 (6, 45)  10,4 ± 9,2 (intervalo: 1,2–28,9) 
Pacientes sem mutações heterozigóticas do IL36RN  42 (14/28)  48,1 ± 12,3 (intervalo: 26–78)  44,3 ± 12,6(intervalo: 24–63)  26 (4, 35)  16,1 ± 11,1(intervalo: 2,1–49,0) 

IASPPP, Índice de Área e Gravidade da Psoríase Pustulosa Palmoplantar.

Quatro mutações distintas do IL36RN foram identificadas em nove dos 51 pacientes com PPP. As quatro variantes de nucleotídeo único, não sinônimas, foram c.140A>G/p.Asn47Se em cinco pacientes, c.169G>A/p.Val57IIe em um paciente, c.258G>A/p.Met86IIe em dois pacientes. A quarta mutação, c.115+6T>C no íntron 3, foi observada em um paciente. Todas as mutações eram heterozigóticas e nenhum paciente apresentou uma mutação homozigótica ou heterozigótica composta. A figura 1 apresenta os eletroferogramas de todas as variantes.

Figura 1.

Cromatograma de sequência das variantes heterozigóticas do IL36RN na pustulose palmoplantar.

(0,19MB).

Como resultado das previsões funcionais, as mutações p.Asn47Ser e p.Met86IIe foram classificadas como provavelmente prejudiciais por PolyPhen, mas como toleráveis pelo SIFT. p.Val57IIe foi classificada como benigna e tolerável por PolyPhen e SIFT.

As idades médias de início da PPP com e sem a heterozigosidade IL36RN foram de 48,7 ± 7,1 e 44,3 ± 12,6 anos, respectivamente. Não foi observada diferença estatisticamente significativa entre os grupos (p = 0,378). A duração mediana da doença (percentil 25, percentil 75) foi de 14 (6, 36) meses para todos os pacientes com PPP, 12,5 (6, 45) meses para pacientes com variantes IL36RN heterozigotas e 26 (4, 35) meses para pacientes sem essas variantes. Novamente, não foi observada diferença estatisticamente significativa (W = 165,5; p = 0,711). Os escores IASPPP médios foram 10,4 ± 9,2 para pacientes com mutações heterozigóticas de IL36RN e 16,1 ± 11,1 para pacientes sem essas mutações, sem diferença significativa entre eles (p = 0,219). Também não foram observadas diferenças entre o escore IASPPP, duração da doença e idade de início entre pacientes com ou sem mutação do IL36RN após ajuste por sexo, idade e história familiar de PPP (todos p > 0,1). A figura 2 apresenta as manifestações clínicas de dois pacientes com ou sem mutações no IL36RN.

Figura 2.

Quadro clínico: pustulose palmoplantar das mãos. A, paciente com mutação heterozigótica c.140A>G/p.Asn47Ser; B, paciente sem mutação de IL36RN.

(0,26MB).
Discussão

O gene IL36RN está localizado no braço longo do cromossomo 2 e consiste de cinco éxons, codificam o antagonista da IL‐36, IL‐36Ra.11,12 A IL‐36Ra inibe a resposta inflamatória mediada pela IL‐36, liga‐se ao receptor da IL‐36.13 Mutações patogênicas de IL‐36RN causam doenças como PPG.6,14,15 A PPP é considerada uma forma localizada de PPG.4

Tem sido demonstrado que muitos casos de PPG são causados por mutações do gene IL36RN.16 No entanto, a literatura apresenta apenas três estudos da mutação IL36RN em PPP até o momento, feitos em grupos étnicos diversos. Setta‐Kaffetzi et al. descobriram que sete pacientes com PPP apresentavam uma variante p.Ser113Leu e quatro eram homozigotos, com taxas de mutação similares àquelas encontradas para PPG em seu estudo, indicou‐se que os alelos IL36RN estavam associados a um perfil fenotípico que inclui PPP e PPG.9 Em contraste, Mossner et al., ao avaliar 251 pacientes com PPP, identificaram quatro indivíduos com variantes heterozigóticas do IL36RN que não apresentavam patogenicidade, o que sugeriu que a PPP não estava associada a mutações do IL36RN com perda de função em europeus.8 Takahashi et al. descobriram que quatro de 88 pacientes japoneses com PPP tinham variantes heterozigóticas do IL36RN e concluíram que essas variantes não pareciam estar associadas ao fenótipo de PPP.7 Os resultados divergentes apresentados nesses estudos podem ter sido causados pelas diferentes etnias das populações estudadas. Este é o primeiro estudo que avaliou a mutação do IL36RN em pacientes chineses com PPP. O presente estudo indicou que pode não haver associação entre a mutação do IL36RN e a PPP em pacientes chineses.

Quinze mutações distintas foram identificadas em pacientes com PPG; p.Ser113Leu, p.Leu27Pro e c.115+6T>C foram as variantes mais comuns em populações europeias, africanas e asiáticas, respectivamente.17 c.115+6T>C e c.227T>C foram identificadas como as mutações do IL36RN fundadoras em estudos de pacientes chineses.5,17

No presente estudo, quatro variantes do IL36RN foram identificadas em pacientes chineses com PPP. A variante heterozigótica c.140A>G/p.Asn47Ser foi encontrada em cinco pacientes (9,8%). De acordo com dados obtidos no site da University of California Santa Cruz (UCSC) do 1,000 Genomes Project, 66 entre 5.008 (1,3%) indivíduos saudáveis são portadores dessa variante. Li et al. sugeriram que, entre 373 indivíduos chineses saudáveis, 25 (6,7%) apresentavam p.Asn47Ser, dos quais 24 eram heterozigotos e um era homozigoto.17 Hayashi et al. relataram que, entre 1.120 indivíduos saudáveis japoneses, 76 apresentavam uma variante heterozigótica p.Asn47Ser e um apresentava uma variante homozigótica (6,9% no total).18 Além disso, a frequência de portadores de p.Asn47Ser entre 111 pacientes chineses com psoríase vulgar foi de 9,0%; assim, é provável que p.Asn47Ser seja um polimorfismo na PPP.17

O genótipo mutante mais comum em pacientes asiáticos com PPG na China, Japão e Malásia é o c.115+6T>C.16,17,19 Um paciente (2,0%) no presente estudo e sete de 168 (4,2%) controles saudáveis em um estudo anterior dos autores apresentavam essa variante heterozigótica.20 Além disso, Li et al. descobriram que a frequência de c.115+6T>C foi de 3,6% em controles saudáveis e 1,8% em pacientes com psoríase vulgar, maior do que a observada no grupo PPP no presente estudo.17

c.169G>A/p.Val57IIe e c.258G>A/p.Met86IIe foram detectados em um e dois pacientes, respectivamente, não foram sido relatados anteriormente. A partir dos dados disponíveis, as variantes heterozigóticas p.Val57IIe ou p.Met86IIe podem não estar associadas à manifestação de PPG ou PPP. p.Val57IIe foi classificado como benigno e tolerável por PolyPhen e SIFT, enquanto p.Met86IIe foi classificado como tolerável pelo SIFT. Assim, essas variantes podem não ser mutações patogênicas causadoras de PPP.

De modo geral, não foi observada diferença na gravidade da doença, idade de início ou duração da doença entre pacientes com variantes heterozigóticas do IL36RN e aqueles sem essas variantes. O IL36RN pode não estar associado à manifestação clínica da PPP. Outra evidência é que as lesões de pele em pacientes PPP com mutação heterozigota do IL36RN apresentaram imunomarcação positiva para IL‐36Ra em uma análise imuno‐histoquímica, não mostraram diferença em relação a controles normais.7 Além disso, Onoufriadis et al. concluíram que três pacientes com PPG apresentavam mutações homozigotas (p.Ser113Leu) ou heterozigotas compostas (p.Ser113Leu, p.Arg48Trp), mas nenhuma mutação foi observada em outros dois pacientes com PPG complicado com PPP.14 Esses autores especularam que o IL36RN está envolvido na PPG, mas não está associado à PPP, o que é consistente com a conclusão do presente estudo. Assim, as variantes heterozigóticas do IL36RN aqui descritas podem não ser fatores patogênicos na PPP. Outra hipótese indicou que mutações heterozigóticas ou heterozigóticas compostas do IL36RN podem ser um fator predisponente para a PPG com psoríase vulgar, porque variantes heterozigotas do IL36RN foram observadas em três dos 20 pacientes com PPG complicadas com psoríase vulgar.16 No entanto, não se sabe se os pacientes com PPP com uma variante de IL36RN apresentam um risco maior de desenvolver PPG; mais estudos são necessários para esclarecer esse ponto.

Conclusão

As quatro variantes do IL36RN detectadas neste estudo de 51 pacientes chineses provavelmente não estão associadas à patogênese da PPP. Esses resultados estão em concordância com estudos europeus e japoneses, sugerindo que as mutações do IL36RN não são o fator patogênico da PPP.

Suporte financeiro

Fundação Nacional de Ciências Naturais da China 81773331; Fundos de Capitais para Melhoria da Saúde e Pesquisa 2016‐2‐4018.

Contribuição dos autores

Yu Xiaoling: Análise estatística; aprovação da versão final do manuscrito; concepção e planejamento do estudo; elaboração e redação do manuscrito; obtenção, análise e interpretação dos dados; participação intelectual em conduta propedêutica e/ou terapêutica de casos estudados; revisão crítica da literatura.

Shu Dan: Aprovação da versão final do manuscrito; concepção e planejamento do estudo; participação efetiva na orientação da pesquisa; revisão crítica do manuscrito.

Jin Hongzhong: Aprovação da versão final do manuscrito; concepção e planejamento do estudo; participação efetiva na orientação da pesquisa; participação intelectual em conduta propedêutica e/ou terapêutica de casos estudados; revisão crítica do manuscrito.

Conflitos de interesse

Nenhum.

Referências
[1]
E. Adişen, M.A. Gürer.
Therapeutic options for palmoplantar pustulosis.
Clin Exp Dermatol., 35 (2010), pp. 219-222
[2]
R. Giménez-García, S. Sánchez-Ramón, L.A. Cuellar-Olmedo.
Palmoplantar pustulosis: a clinicoepidemiological study The relationship between tobacco use and thyroid function.
J Eur Acad Dermatol Venereol., 17 (2003), pp. 276-279
[3]
H. Song, W. Yin, Q. Ma.
Allergic palmoplantar pustulosis caused by cobalt in cast dental crowns: a case report.
Oral Surg Oral Med Oral Pathol Oral Radiol Endod., 111 (2011), pp. e8-e10
[4]
M. Misiak-Galazka, H. Wolska, L. Rudnicka.
What do we know about palmoplantar pustulosis?.
J Eur Acad Dermatol Venereol., 31 (2017), pp. 38-44
[5]
X. Li, M. Chen, X. Fu, Q. Zhang, Z. Wang, G. Yu, et al.
Mutation analysis of the IL36RN gene in Chinese patients with generalized pustular psoriasis with/without psoriasis vulgaris.
J Dermatol Sci., 76 (2014), pp. 132-138
[6]
S. Marrakchi, P. Guigue, B.R. Renshaw, A. Puel, X.Y. Pei, S. Fraitag, et al.
Interleukin‐36‐receptor antagonist deficiency and generalized pustular psoriasis.
N Engl J Med., 365 (2011), pp. 620-628
[7]
T. Takahashi, N. Fujimoto, M. Kabuto, T. Nakanishi, T. Tanaka.
Mutation analysis of IL36RN gene in Japanese patients with palmoplantar pustulosis.
J Dermatol., 44 (2017), pp. 80-83
[8]
R. Mössner, Y. Frambach, D. Wilsmann-Theis, S. Löhr, A. Jacobi, A. Weyergraf, et al.
Palmoplantar pustular psoriasis is associated with missense variants in CARD14, but not with loss‐of‐function mutations in IL36RN in European patients.
J Invest Dermatol., 135 (2015), pp. 2538-2541
[9]
N. Setta-Kaffetzi, A.A. Navarini, V.M. Patel, V. Pullabhatla, A.E. Pink, S.E. Choon, et al.
Rare pathogenic variants in IL36RN underlie a spectrum of psoriasis‐associated pustular phenotypes.
J Invest Dermatol., 133 (2013), pp. 1366-1369
[10]
M. Bhushan, A.D. Burden, K. McElhone, R. James, F.P. Vanhoutte, C.E. Griffiths.
Oral liarozole in the treatment of palmoplantar pustular psoriasis: a randomized, double‐blind, placebo‐controlled study.
Br J Dermatol., 145 (2001), pp. 546-553
[11]
D.E. Smith, B.R. Renshaw, R.R. Ketchem, M. Kubin, K.E. Garka, J.E. Sims.
Four new members expand the interleukin‐1 superfamily.
J Biol Chem., 275 (2000), pp. 1169-1175
[12]
J.E. Towne, K.E. Garka, B.R. Renshaw, G.D. Virca, J.E. Sims.
Interleukin (IL)‐1F6 IL‐1F8, and IL‐1F9 signal through IL‐1Rrp2 and IL‐1RAcP to activate the pathway leading to NF‐kappaB and MAPKs.
J Biol Chem., 279 (2004), pp. 13677-13688
[13]
J.E. Towne, B.R. Renshaw, J. Douangpanya, B.P. Lipsky, M. Shen, C.A. Gabel, et al.
Interleukin‐36 (IL‐36) ligands require processing for full agonist (IL‐36α IL‐36β, and IL‐36γ) or antagonist (IL‐36Ra) activity.
J Biol Chem., 286 (2011), pp. 42594-42602
[14]
A. Onoufriadis, M.A. Simpson, A.E. Pink, P. Di Meglio, C.H. Smith, V. Pullabhatla, et al.
Mutations in IL36RN/IL1F5 are associated with the severe episodic inflammatory skin disease known as generalized pustular psoriasis.
Am J Hum Genet., 89 (2011), pp. 432-437
[15]
M. Farooq, H. Nakai, A. Fujimoto, H. Fujikawa, A. Matsuyama, N. Kariya, et al.
Mutation analysis of the IL36RN gene in 14 Japanese patients with generalized pustular psoriasis.
Hum Mutat., 34 (2013), pp. 176-183
[16]
K. Sugiura, A. Takemoto, M. Yamaguchi, H. Takahashi, Y. Shoda, T. Mitsuma, et al.
The majority of generalized pustular psoriasis without psoriasis vulgaris is caused by deficiency of interleukin‐36 receptor antagonist.
J Invest Dermatol., 133 (2013), pp. 2514-2521
[17]
M. Li, J. Han, Z. Lu, H. Li, K. Zhu, R. Cheng, et al.
Prevalent and rare mutations in IL‐36RN gene in Chinese patients with generalized pustular psoriasis and psoriasis vulgaris.
J Invest Dermatol., 133 (2013), pp. 2637-2639
[18]
M. Hayashi, T. Nakayama, T. Hirota, H. Saeki, Y. Nobeyama, T. Ito, et al.
Novel IL36RN gene mutation revealed by analysis of 8 Japanese patients with generalized pustular psoriasis.
J Dermatol Sci., 76 (2014), pp. 267-269
[19]
T.S. Wang, H.Y. Chiu, J.B. Hong, C.C. Chan, S.J. Lin, T.F. Tsai.
Correlation of IL36RN mutation with different clinical features of pustular psoriasis in Chinese patients.
Arch Dermatol Res., 308 (2016), pp. 55-63
[20]
D. Shu, H.Z. Jin.
Mutation analysis of IL36RN in a Chinese Daur family with generalized pustular psoriasis.
Eur J Dermatol., 24 (2014), pp. 415-416

Como citar este artigo: Xiaoling Y, Dan S, Hongzhong J. Lack of association between mutation in IL36RN and palmoplantar pustular psoriasis in Chinese patients. An Bras Dermatol. 2019;94:658–63.

Trabalho realizado no Hospital‐Escola Peking Union, Academia Chinesa de Ciências Médicas, Faculdade de Medicina Peking Union, Pequim, China.

Idiomas
Anais Brasileiros de Dermatologia (Portuguese)

Receba a nossa Newsletter

Opções de artigo
Ferramentas
en pt
Cookies policy Política de cookies
To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here. Utilizamos cookies próprios e de terceiros para melhorar nossos serviços e mostrar publicidade relacionada às suas preferências, analisando seus hábitos de navegação. Se continuar a navegar, consideramos que aceita o seu uso. Você pode alterar a configuração ou obter mais informações aqui.